Details of Primer Pair 'ABC01644_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01644_L01R01415Nils Rostoks2003-12-01 ABC01644_L01 CGAGGATTGGCTCAAGACGC 451 20 Nils Rostoks 2003-12-01 Illumina
ABC01644_R01 GCAGCGTTCTTAGGACTGGCA 865 21 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01644_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina