Details of Primer Pair 'ABC01646_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01646_L01R01463Nils Rostoks2003-12-01 ABC01646_L01 ACCAAGTCCATGAGGCAGGC 836 20 Nils Rostoks 2003-12-01 Illumina
ABC01646_R01 GCACGCCCCAAAAACAGACT 1298 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01646_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina