Details of Primer Pair 'ABC01648_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01648_L02R020Nils Rostoks2005-03-17 ABC01648_L02 AGAGCAATGGTGACGCTCTT 0 20 Nils Rostoks 2005-03-17 Invitrogen
ABC01648_R02 ATCAAGAGGGCGATCAAGAA 1006 20 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC01648_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01648_L01R01400Nils Rostoks2003-12-01 ABC01648_L01 AGTTCCAAGTCGGCCCTTCC 805 20 Nils Rostoks 2003-12-01 Illumina
ABC01648_R01 CGGTCCTCGAAGTAGCCCCT 1204 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01648_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC01648_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina