Details of Primer Pair 'ABC01650_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01650_L01R01411Nils Rostoks2003-12-01 ABC01650_L01 GTCAAGATGCAGGCGTCCCT 1611 20 Nils Rostoks 2003-12-01 Illumina
ABC01650_R01 GGAGGCCAGGAACCGAACTT 2021 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01650_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina