Details of Primer Pair 'ABC01728_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01728_L01R01111Nils Rostoks2005-03-17 ABC01728_L01 CTCATCGCCGAGAAGAACTG 180 20 Nils Rostoks 2005-03-17 Invitrogen
ABC01728_R01 GCTTCTTCATCGTCCCGAAC 291 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC01728_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB