Details of Primer Pair 'ABC01741_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01741_L01R01553Nils Rostoks2003-12-01 ABC01741_L01 TGAGGCTGGCACAACTGGTC 625 20 Nils Rostoks 2003-12-01 Illumina
ABC01741_R01 GCTGCAAAAGCAAGCAAGCA 1177 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01741_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina