Details of Primer Pair 'ABC01797_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01797_L01R01477Nils Rostoks2003-12-01 ABC01797_L01 GGAGACCTCCATCTTCGCCA 1988 20 Nils Rostoks 2003-12-01 Illumina
ABC01797_R01 GGCAGCGGAAAAACAACAGC 2464 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01797_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina