Details of Primer Pair 'ABC01808_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01808_L01R01440Nils Rostoks2003-12-01 ABC01808_L01 CGCGATTTCGACGTTTAGGG 1783 20 Nils Rostoks 2003-12-01 Illumina
ABC01808_R01 ACACCCACCGAGAGAGGCTG 2222 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01808_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina