Details of Primer Pair 'ABC01812_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01812_L01R01447Nils Rostoks2003-12-01 ABC01812_L01 TCCTGTGCGGGAACAAGGTT 443 20 Nils Rostoks 2003-12-01 Illumina
ABC01812_R01 AGCCCACCAGACAAGGCAAG 889 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01812_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina