Details of Primer Pair 'ABC01834_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01834_L01R01452Nils Rostoks2003-12-01 ABC01834_L01 CCGGTCAGGATAAGGGGAGG 82 20 Nils Rostoks 2003-12-01 Illumina
ABC01834_R01 TGAAAGCACACACGAGCGGT 533 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01834_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina