Details of Primer Pair 'ABC01864_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01864_L01R01412Nils Rostoks2003-12-01 ABC01864_L01 CGATGAACCTGGCCTTCCTG 163 20 Nils Rostoks 2003-12-01 Illumina
ABC01864_R01 TGGCCCGTCCATCCATTTAC 574 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01864_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina