Details of Primer Pair 'ABC01865_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01865_L01R01448Nils Rostoks2003-12-01 ABC01865_L01 CTGGACGTGCTCAGAGCCAA 550 20 Nils Rostoks 2003-12-01 Illumina
ABC01865_R01 GATCCGTGACCGGCCTAATG 997 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01865_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina