Details of Primer Pair 'ABC01868_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01868_L01R01402Nils Rostoks2003-12-01 ABC01868_L01 CCCACCATAAGCCCCACCTT 704 20 Nils Rostoks 2003-12-01 Illumina
ABC01868_R01 CTAGCCAATGCTTCCTGCGG 1105 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01868_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina