Details of Primer Pair 'ABC01964_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC01964_L01R01465Nils Rostoks2003-12-01 ABC01964_L01 ACCTCGGAGTCCACGTGAGG 440 20 Nils Rostoks 2003-12-01 Illumina
ABC01964_R01 CAAGTGGGAAAGGGGTGTCG 904 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC01964_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina