Details of Primer Pair 'ABC02109_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02109_L01R01175Nils Rostoks2005-03-17 ABC02109_L01 CTATAAATGGGCAGCGGAAG 799 20 Nils Rostoks 2005-03-17 Invitrogen
ABC02109_R01 CACGGCGACATGGATTTATT 624 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02109_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB