Details of Primer Pair 'ABC02112_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02112_L01R01464Nils Rostoks2003-12-01 ABC02112_L01 CCTCAACACGGTCGACATGG 589 20 Nils Rostoks 2003-12-01 Illumina
ABC02112_R01 CTGGAGAGCTGCCGGATTGT 1052 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02112_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina