Details of Primer Pair 'ABC02113_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02113_L01R01554Nils Rostoks2003-12-01 ABC02113_L01 CTTCACCGTCACCGACATGG 562 20 Nils Rostoks 2003-12-01 Illumina
ABC02113_R01 GCACCACTGGGCCTTTATGG 1115 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02113_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina