Details of Primer Pair 'ABC02116_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02116_L01R01421Nils Rostoks2003-12-01 ABC02116_L01 ACGACGACGCCCAACACTTT 128 20 Nils Rostoks 2003-12-01 Illumina
ABC02116_R01 ATCTCTCCTCTGCATGCCCG 548 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02116_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina