Details of Primer Pair 'ABC02159_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02159_L01R01505Nils Rostoks2003-12-01 ABC02159_L01 CCGTTGTCATGGCTGGAGTG 286 20 Nils Rostoks 2003-12-01 Illumina
ABC02159_R01 ACCCAGCATCCTGACGGAAA 790 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02159_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina