Details of Primer Pair 'ABC02236_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02236_L01R01158Nils Rostoks2005-03-17 ABC02236_L01 TTCCTGCTAGTTTGCTAATCG 102 21 Nils Rostoks 2005-03-17 Invitrogen
ABC02236_R01 TGGCGAGGAAGTAGAAGAGG 260 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02236_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB