Details of Primer Pair 'ABC02258_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02258_L01R01539Nils Rostoks2003-12-01 ABC02258_L01 CTTCCCACCCGGCCTACTTC 157 20 Nils Rostoks 2003-12-01 Illumina
ABC02258_R01 GGCCATGGGATCAGATCAGG 695 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02258_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina