Details of Primer Pair 'ABC02265_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02265_L01R01447Nils Rostoks2003-12-01 ABC02265_L01 TGTCAAGAACAACCCGGCAG 1390 20 Nils Rostoks 2003-12-01 Illumina
ABC02265_R01 GCTGGTCCTAGCCGTTCCCT 1836 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02265_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina