Details of Primer Pair 'ABC02273_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02273_L01R01455Nils Rostoks2003-12-01 ABC02273_L01 GCAAGGTCGAAATCATGGGG 97 20 Nils Rostoks 2003-12-01 Illumina
ABC02273_R01 TGCCATTTATTATCTCAGGACGCA 551 24 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02273_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina