Details of Primer Pair 'ABC02281_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02281_L01R01154Nils Rostoks2005-03-17 ABC02281_L01 ATGCAGTGCTCATTCTTGATG 1335 21 Nils Rostoks 2005-03-17 Invitrogen
ABC02281_R01 GGCTACTGCAGTCGACGAT 1181 19 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02281_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB