Details of Primer Pair 'ABC02282_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02282_L01R01415Nils Rostoks2003-12-01 ABC02282_L01 TACGGGTGCCTGAGGTGGAT 725 20 Nils Rostoks 2003-12-01 Illumina
ABC02282_R01 CGATTATTGCAGCAGCGACG 1139 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02282_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina