Details of Primer Pair 'ABC02294_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02294_L01R01408Nils Rostoks2003-12-01 ABC02294_L01 GCTCCTCCAGTACTCGCCCA 1335 20 Nils Rostoks 2003-12-01 Illumina
ABC02294_R01 CATGGTCAAGCTTGCATCGC 1742 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02294_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina