Details of Primer Pair 'ABC02306_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02306_L01R010Nils Rostoks2005-03-17 ABC02306_L01 TGCCTTGTTTATGTAATATCTTGTG 0 25 Nils Rostoks 2005-03-17 Invitrogen
ABC02306_R01 GGCGTAAATAAGAGTGTCTTCAG 123 23 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02306_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB