Details of Primer Pair 'ABC02329_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02329_L01R01438Nils Rostoks2003-12-01 ABC02329_L01 CATGGCCACGAAGCTCAATG 833 20 Nils Rostoks 2003-12-01 Illumina
ABC02329_R01 GGGGAAAACGTGAAGAGCCC 1270 20 Nils Rostoks 2003-12-01 Illumina

Comment History of 'ABC02329_L01R01'

DateSubmitterComment
2003-12-01 Nils Rostoks Abiotic stress gene primer test from Illumina