Details of Primer Pair 'ABC02403_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02403_L01R01473Nils Rostoks2004-01-26 ABC02403_L01 GGGAGGAACAGTGCCTGCAA 817 20 Nils Rostoks 2004-01-26 Illumina
ABC02403_R01 CCAGTCCTGGCACAACCACA 1289 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02403_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes