Details of Primer Pair 'ABC02416_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02416_L01R01443Nils Rostoks2004-01-26 ABC02416_L01 GTGCGACCACAAGTGCCAAC 474 20 Nils Rostoks 2004-01-26 Illumina
ABC02416_R01 GGAGAGGCATCGCCAATCAT 916 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02416_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes