Details of Primer Pair 'ABC02493_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02493_L01R01447Nils Rostoks2004-01-26 ABC02493_L01 CCCTCAGGGTGTTGGTGGAC 631 20 Nils Rostoks 2004-01-26 Illumina
ABC02493_R01 TCATCTCGCCAAGAACCCAA 1077 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02493_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes