Details of Primer Pair 'ABC02503_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02503_L02R020Nils Rostoks2005-03-17 ABC02503_L02 AACAACTTTTGATGGACAAACC 0 22 Nils Rostoks 2005-03-17 Invitrogen
ABC02503_R02 TGTCTTTTCTTTTTGCTCTGC 1124 21 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC02503_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02503_L01R01441Nils Rostoks2004-01-26 ABC02503_L01 TCCCGTGGGAGATGTTCGTT 775 20 Nils Rostoks 2004-01-26 Illumina
ABC02503_R01 TGCCTTTGCATTTTGTGCCA 1215 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02503_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC02503_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes