Details of Primer Pair 'ABC02507_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02507_L01R01401Nils Rostoks2004-01-26 ABC02507_L01 CTGCCGAAGCGGAGACTGAT 1277 20 Nils Rostoks 2004-01-26 Illumina
ABC02507_R01 AGCAGGCGTGGACCTGAACT 1677 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02507_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes