Details of Primer Pair 'ABC02555_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02555_L01R01525Nils Rostoks2004-01-26 ABC02555_L01 GGTGCTACCTGCTGCGATGA 347 20 Nils Rostoks 2004-01-26 Illumina
ABC02555_R01 GACCAGCGGGCAACATAAGC 871 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02555_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes