Details of Primer Pair 'ABC02581_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02581_L01R01430Nils Rostoks2004-01-26 ABC02581_L01 TGGCCAGATCAAGGATGGGT 542 20 Nils Rostoks 2004-01-26 Illumina
ABC02581_R01 GCATCCTGAAAAGATGCACGG 971 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02581_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes