Details of Primer Pair 'ABC02587_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02587_L01R01199Nils Rostoks2005-03-17 ABC02587_L01 GGTGACCCAGCCAAATTTTA 847 20 Nils Rostoks 2005-03-17 Invitrogen
ABC02587_R01 GCAGCTGCTAGTTGGTTCATC 648 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02587_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB