Details of Primer Pair 'ABC02590_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02590_L01R01431Nils Rostoks2004-01-26 ABC02590_L01 GCAGGAAGGCCATGCTGAAG 311 20 Nils Rostoks 2004-01-26 Illumina
ABC02590_R01 TCACAAGGTTGGGAACGGCT 741 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02590_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes