Details of Primer Pair 'ABC02594_L02R03'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02594_L02R03144Nils Rostoks2004-05-27 ABC02594_L02 TCCGGAAAATCATCGTGCAG 483 20 Nils Rostoks 2004-05-27 Qiagen
ABC02594_R03 TGCCTGATACGCTTGTCTG 627 19 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC02594_L02R03'

2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined