Details of Primer Pair 'ABC02614_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02614_L01R01400Nils Rostoks2004-01-26 ABC02614_L01 ACGAAACACAGGGGGAGTGG 395 20 Nils Rostoks 2004-01-26 Illumina
ABC02614_R01 AAGCCCCGAAAGGCAAACAT 794 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02614_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes