Details of Primer Pair 'ABC02622_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02622_L02R02293Nils Rostoks2005-03-17 ABC02622_L02 TCATGCATGGTAGAGGTCCA 1927 20 Nils Rostoks 2005-03-17 Invitrogen
ABC02622_R02 TTGAGAACCACTCGTCAGGA 1634 20 Nils Rostoks 2005-03-17 Invitrogen

Details of Primer Pair 'ABC02622_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02622_L01R01555Nils Rostoks2004-01-26 ABC02622_L01 GCGATACGACGCCGAGAAAG 1490 20 Nils Rostoks 2004-01-26 Illumina
ABC02622_R01 TGGACGGCTCAATGGAACAA 2044 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02622_L02R02'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB

Comment History of 'ABC02622_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes