Details of Primer Pair 'ABC02639_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02639_L01R01496Nils Rostoks2004-01-26 ABC02639_L01 TCCAGGATGACAAGGTCGGG 648 20 Nils Rostoks 2004-01-26 Illumina
ABC02639_R01 CTCCCGGAGTCCCAATCTCA 1143 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02639_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes