Details of Primer Pair 'ABC02737_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02737_L01R01431Nils Rostoks2004-01-26 ABC02737_L01 ACCAGTCGTCACCGTGGGTT 1151 20 Nils Rostoks 2004-01-26 Illumina
ABC02737_R01 GAAGCCTGAAAATGCGTGCC 1581 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02737_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes