Details of Primer Pair 'ABC02738_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02738_L01R01470Nils Rostoks2004-01-26 ABC02738_L01 TTGGGTCATCAACACCGTGG 1331 20 Nils Rostoks 2004-01-26 Illumina
ABC02738_R01 CCGGGCTTATTCATGCATCC 1800 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02738_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes