Details of Primer Pair 'ABC02739_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02739_L01R01470Nils Rostoks2004-01-26 ABC02739_L01 TTGGGTCATCAACACCGTGG 90 20 Nils Rostoks 2004-01-26 Illumina
ABC02739_R01 CCGGGCTTATTCATGCATCC 559 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02739_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes