Details of Primer Pair 'ABC02748_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02748_L01R01150Nils Rostoks2005-03-17 ABC02748_L01 GGTGCATTTGGAAGTCTAGG 55 20 Nils Rostoks 2005-03-17 Invitrogen
ABC02748_R01 ATAGCAAGTGCCAAGTGAGC 205 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC02748_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB