Details of Primer Pair 'ABC02771_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02771_L01R01564Nils Rostoks2004-01-26 ABC02771_L01 TGGAGATGTTATCGACGCGG 196 20 Nils Rostoks 2004-01-26 Illumina
ABC02771_R01 GTGGCATGCTGAATTTCCGA 759 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02771_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes