Details of Primer Pair 'ABC02786_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02786_L01R01407Nils Rostoks2004-01-26 ABC02786_L01 AATCAGGCTGTGGAGCGAGC 1817 20 Nils Rostoks 2004-01-26 Illumina
ABC02786_R01 TGGCGCTGGAGACCAAATAA 2223 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02786_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes