Details of Primer Pair 'ABC02813_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02813_L01R01404Nils Rostoks2004-01-26 ABC02813_L01 AGAACAAGGAGCGCACGGAC 523 20 Nils Rostoks 2004-01-26 Illumina
ABC02813_R01 TGAAGGGCAGAGTGGTGCAG 926 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02813_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes