Details of Primer Pair 'ABC02838_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02838_L01R01508Nils Rostoks2004-01-26 ABC02838_L01 GGAGCCATGAGGTTTGTCCG 631 20 Nils Rostoks 2004-01-26 Illumina
ABC02838_R01 TCTTCAGAAGGTCAGGGCCG 1138 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02838_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes