Details of Primer Pair 'ABC02877_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC02877_L01R01416Nils Rostoks2004-01-26 ABC02877_L01 TCAAGAGAGTGCCGTGCGAG 542 20 Nils Rostoks 2004-01-26 Illumina
ABC02877_R01 CCATGCAAAACGATCCGTGA 957 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC02877_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes